Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.007579 |
Chromosome: | chromosome 1 |
Location: | 6066487 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g042800 | DVR1 | 3%252C8-Divinyl protochlorophyllide a 8-vinyl reductase, chloroplast precursor; (1 of 1) K19073 - divinyl chlorophyllide a 8-vinyl-reductase (DVR) | 5'UTR |
Cre01.g042850 | (1 of 2) K17278 - membrane-associated progesterone receptor component (PGRMC1_2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATGGACAATTGACTCGTGGCGCGGGAATCCCAGTAGGCAACTCTAAGG |
Internal bar code: | TGGTATTGACTTACGGTAGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 346 |
LEAP-Seq percent confirming: | 12.5 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTGTTGCGAGCAAGATAGC |
Suggested primer 2: | TCTTCCGATTGTGCCTCCAC |