| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.007580 |
| Chromosome: | chromosome 12 |
| Location: | 2001484 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510800 | CHLI2 | (1 of 2) PTHR32039//PTHR32039:SF9 - FAMILY NOT NAMED // MAGNESIUM-CHELATASE SUBUNIT CHLI-2, CHLOROPLASTIC; Magnesium chelatase subunit I, isoform 2 with histidine kinase activity | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTAGTGGGGTTGAGGGGGCGAGGACTCCAGCGCGCGATACATGCCATGT |
| Internal bar code: | GTAGCTGAACCGCTAGCTGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2347 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTAACCGTGCTCTGTCCCAC |
| Suggested primer 2: | AGAGCGACAAAGTGACAGGG |