| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.007634 |
| Chromosome: | chromosome 12 |
| Location: | 2200723 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g509000 | MAPK3 | Mitogen-Activated Protein Kinase 3; (1 of 3) K04371 - mitogen-activated protein kinase 1/3 (MAPK1_3) | 3'UTR |
| Cre12.g509050 | PPL1,PSBP3 | PsbP-like protein of thylakoid lumen; (1 of 1) PTHR31407:SF4 - PSBP-LIKE PROTEIN 1, CHLOROPLASTIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCGCTACACCCGGCACCAGCTGGCCGTCGTGGCCGCCAACAACGGTG |
| Internal bar code: | ACAGGGGTTTACTCCGTTAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2238 |
| LEAP-Seq percent confirming: | 53.3333 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCCAGTCATGCAGTGGTG |
| Suggested primer 2: | AGCAGAGGGTCTCTCAGGAG |