Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.007771 |
Chromosome: | chromosome 14 |
Location: | 1923791 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g620300 | ASB1,ANS2 | Anthranilate synthase, beta subunit; (1 of 1) K01658 - anthranilate synthase component II (trpG) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAATTTAGCGGGACTGGGCAAAAGGGCATCCAGGTGCACAACTTGCAT |
Internal bar code: | GATGTGTTAGTCGCATCAGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3751 |
LEAP-Seq percent confirming: | 96.0 |
LEAP-Seq n confirming: | 72 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCCTCACCTAGCCCTCTT |
Suggested primer 2: | TCCACGGTTTTCTCGTCGTT |