Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.009169 |
Chromosome: | chromosome 9 |
Location: | 2121061 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396000 | NAR5,NRT2C | Nitrate/nitrite transporter; (1 of 4) K02575 - MFS transporter, NNP family, nitrate/nitrite transporter (NRT, narK, nrtP, nasA) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGGGACCTCAGGCTGCACGGGTACGGAGCTGGGTACGGAGGGTAGCGG |
Internal bar code: | CGATCTAGAAATGTGATGAGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 630 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 39 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACTACCGCGACCTGAAAA |
Suggested primer 2: | CAGCATACCGTTCACGCATG |