| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.009431 |
| Chromosome: | chromosome 4 |
| Location: | 2651289 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g223050 | CAH2 | (1 of 2) PTHR18952:SF104 - CARBONIC ANHYDRASE-RELATED PROTEIN; Carbonic anhydrase, alpha type%252C periplasmic | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAAAACAACATCCTCGTTCCAACTCGCACTTGATCATTGCGAGACATG |
| Internal bar code: | CGAACTCTTCGATGAATCGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 515 |
| LEAP-Seq percent confirming: | 48.2759 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGCTGGGCTTACTGTACC |
| Suggested primer 2: | AAACCCTGATGCCTCCCATG |