| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.010439 |
| Chromosome: | chromosome 6 |
| Location: | 2710859 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g270850 | SRH12 | (1 of 1) K10841 - DNA excision repair protein ERCC-6 (ERCC6, CSB, RAD26); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTCCTCCCGCCCTTCAAGAGCAAGAGCTGAGCCGTTTTCATTACGCG |
| Internal bar code: | GAAGCTACCGGAAACGATAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1130 |
| LEAP-Seq percent confirming: | 84.0 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGACCCTCCCCCAGATAC |
| Suggested primer 2: | GGTGATGAGGCGGTAGATGG |