Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.010630 |
Chromosome: | chromosome 10 |
Location: | 6756091 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g467200 | ATR1 | (1 of 2) PTHR11139:SF69 - SERINE/THREONINE-PROTEIN KINASE ATR; ATM/ATR-related phosphatidylinositol 3-kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAAACGGGGGTTGGAGTCTTGAAGTCATTGGCCGAGCGCATGCATAT |
Internal bar code: | CATGGTTCGGGCTTTTAGTATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1876 |
LEAP-Seq percent confirming: | 86.3636 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCTCACCGCGATGCTATGA |
Suggested primer 2: | TCTGTTGACATGGGTTCCGG |