Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.012058 |
Chromosome: | chromosome 17 |
Location: | 3877307 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g727600 | (1 of 1) PF06650//PF12624//PF16908//PF16909 - SHR-binding domain of vacuolar-sorting associated protein 13 (SHR-BD) // N-terminal region of Chorein or VPS13 (Chorein_N) // Vacuolar sorting-associated protein 13, N-terminal (VPS13) // Vacuolar-sorting-associated 13 protein C-terminal (VPS13_C) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAAATAGGTCTTCTCGCCCTACGGCGCTTGCGCTCCGTCTCCATCGCTC |
Internal bar code: | AGTACATGTAAGATGTGGCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3170 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAAGTCGACTCGGTGAGCTG |
Suggested primer 2: | TCGCTCCACGTTATCAGCTC |