Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.012503 |
Chromosome: | chromosome 10 |
Location: | 2636056 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g437150 | PPR6,CYCR5 | PentatricoPeptide Repeat protein 6; (1 of 2) K17710 - pentatricopeptide repeat domain-containing protein 1 (PTCD1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACTATCCCAGCCTCGCGCTGGGTTGTGGACGGCCCAACTGGTCCAGAT |
Internal bar code: | GGCGATGCGTCGAATTTGGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 906 |
LEAP-Seq percent confirming: | 77.2727 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTTGGATCGGTGAGGATG |
Suggested primer 2: | GAGCGAGTTGTACGTCACCA |