| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.013579 |
| Chromosome: | chromosome 11 |
| Location: | 1662714 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g468356 | TPR7,TPR | (1 of 1) K09291 - nucleoprotein TPR (TPR, MLP1, MLP2); Tetratricopeptide-repeat protein 7 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAGAGAAGTGTAGCGAAGTAGACAGGGGGGGTGAGAGGGTCCGTTGGG |
| Internal bar code: | CCTCAGATGTGGTGGCAAGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 386 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCCCCTTGAACCAACCC |
| Suggested primer 2: | GTCGCTCATGGACTACCTGG |