| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.014394 |
| Chromosome: | chromosome 10 |
| Location: | 2962242 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440200 | SMC5B | (1 of 2) PTHR19306:SF1 - STRUCTURAL MAINTENANCE OF CHROMOSOMES PROTEIN 5; Structural Maintenance of Chromosomes protein | outside_mRNA |
| Cre10.g440250 | PGM19 | Putative phosphoglycerate mutase; (1 of 1) 3.1.3.80 - 2,3-bisphosphoglycerate 3-phosphatase / 2,3-BPG 3-phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCGCGCCTGCGGGGAGCCCGACAGGGCGAGGTCCGGTGTGGAACCGCA |
| Internal bar code: | TAAGTAGCCACTAAATAGCCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2974 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 69 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCATGTGCCATTTCGCG |
| Suggested primer 2: | CATCCAGACACCACACACGA |