| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.015943 |
| Chromosome: | chromosome 1 |
| Location: | 2271260 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012700 | KCN6 | (1 of 4) IPR000595//IPR002110//IPR005821//IPR018490//IPR020683 - Cyclic nucleotide-binding domain // Ankyrin repeat // Ion transport domain // Cyclic nucleotide-binding-like // Ankyrin repeat-containing domain; Voltage-gated potassium channel | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACAGCATGCAGGCGGCCCAGTGCGTGCAGAAGAATACGTAGGTGTAGT |
| Internal bar code: | AACTCAGTCGATGGGGTTGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3860 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCTCCTGTGGAAAGTGAG |
| Suggested primer 2: | GCGTTGTGATGGGCATGATC |