| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.019406 |
| Chromosome: | chromosome 6 |
| Location: | 2607593 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g269950 | CDC48,EZY21,NSG14 | (1 of 1) K13525 - transitional endoplasmic reticulum ATPase (VCP, CDC48); Cell Division Cycle protein 48 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAGACACTAGTATACTTGCTCCTCCTCCCACAGCCGCCCGCCTCGTCT |
| Internal bar code: | TTTGTATCTTTCAGCCAAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1090 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACCCCGAGAAGTTTGAGA |
| Suggested primer 2: | CTGCTGTCCATGCCCAACTA |