| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.020401 |
| Chromosome: | chromosome 3 |
| Location: | 3087561 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g164250 | FAP262 | (1 of 1) PF00612//PF07714 - IQ calmodulin-binding motif (IQ) // Protein tyrosine kinase (Pkinase_Tyr); Flagellar Associated Protein 262, protein kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGCGTCTCGCCCTCCTGCCCGTTTGTAAGCTGCGTCTCGTCGCGCTCA |
| Internal bar code: | TTACTTTGAGTGAAATGTAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2032 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATCCTAACAAGCCGCTG |
| Suggested primer 2: | ATAGGTGCTGCCTCTGCATC |