Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.020962 |
Chromosome: | chromosome 5 |
Location: | 2139066 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g236950 | SRH11 | (1 of 1) K14440 - SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1 [EC:3.6.4.12] (SMARCAL1, HARP); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGTTACAAGGTGGTGAGCACGACGTGCATTCCTGTCCTTGTAGAAAC |
Internal bar code: | TGCACAGACTGTTCGTGGCTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4447 |
LEAP-Seq percent confirming: | 98.0952 |
LEAP-Seq n confirming: | 103 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 105 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGACGTACAAGCAAGCAGA |
Suggested primer 2: | TTGGTCTTAGCGAACCCACC |