| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.020998 |
| Chromosome: | chromosome 11 |
| Location: | 347653 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467575 | CLPB4 | (1 of 1) PF07728//PF10431//PF13191 - AAA domain (dynein-related subfamily) (AAA_5) // C-terminal, D2-small domain, of ClpB protein (ClpB_D2-small) // AAA ATPase domain (AAA_16); ClpB chaperone, Hsp100 family | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGTACTTCAACGGTGAACACCCCCGCCCCCGCCCCCGCCGCATTTCCT |
| Internal bar code: | CGATTCGGTACGGATCGAGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 814 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCAAATGTGCGCGTTTTA |
| Suggested primer 2: | GGACAACCGAAACCTCCGAT |