Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.022156 |
Chromosome: | chromosome 6 |
Location: | 3102656 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g275350 | ROC40 | (1 of 1) PTHR12802//PTHR12802:SF43 - SWI/SNF COMPLEX-RELATED // PROTEIN CCA1-RELATED; Rhythm Of Chloroplast 40 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATTTGCGCACACGTGAAGCACGCACGCCAACACACGCAACACACACAT |
Internal bar code: | GAGACCATATAAGCGCATACCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 858 |
LEAP-Seq percent confirming: | 92.8571 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGACCAGAGAGAGAGATGC |
Suggested primer 2: | AGGCATTCATACACCGCACA |