| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.022519 |
| Chromosome: | chromosome 6 |
| Location: | 1000120 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256700 | (1 of 1) IPR014001//IPR026127//IPR027417 - Helicase superfamily 1/2, ATP-binding domain // Probable RNA helicase SDE3 // P-loop containing nucleoside triphosphate hydrolase | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGCAGTGTGGCCCTTTGAGCTGAAGCTCCAGGGAATGGTCTACGCCC |
| Internal bar code: | ATACTCAGAGTTGGTTCGCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4899 |
| LEAP-Seq percent confirming: | 81.3333 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCATAACGCTCTTGCTGCT |
| Suggested primer 2: | TTTGTCTCCTTCGCCACCTC |