| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.024240 |
| Chromosome: | chromosome 13 |
| Location: | 4223631 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g591700 | TTL15 | (1 of 7) 1.2.1.24 - Succinate-semialdehyde dehydrogenase (NAD(+)); Putative tubulin tyrosine ligase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGGAGATAAGGTAGATGCTTGCCGCCTTAGACGGGAGACGTGGCGTGG |
| Internal bar code: | TTCGGGGACTCAGATTTCCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2780 |
| LEAP-Seq percent confirming: | 97.9592 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTCGCACCACTTCCACAC |
| Suggested primer 2: | GCATCAGCAAAGCTAAGGGC |