| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.024995 |
| Chromosome: | chromosome 6 |
| Location: | 4928913 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281050 | VPS5A | (1 of 2) K17917 - sorting nexin-1/2 (SNX1_2); Subunit of Retromer complex | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCAGCGGCAGCGCCAGTGGGGAATCAGCAGGCTGCGATTTTGCCGGTA |
| Internal bar code: | GGGCTAGATTCTGCGTTCGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4176 |
| LEAP-Seq percent confirming: | 90.8257 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 109 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCACCCAAGTTCTCTGCG |
| Suggested primer 2: | GTGCCGGCTTCTCCTTACTT |