| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.025179 |
| Chromosome: | chromosome 16 |
| Location: | 7556827 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683495 | REX1-S,TFB5,REX1S | (1 of 1) K10845 - TFIIH basal transcription factor complex TTD-A subunit (TTDA, GTF2H5, TFB5); TFB5 subunit of general Transcription Factor II H, involved in Nucleotide Excision Repair | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTCAGGGGTCCAGAGCACAGAACTGTATTACAATTGCCTGCACTCACC |
| Internal bar code: | GAAAATCGTTTATTTAGAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 991 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGCAGCAACCATTTGAA |
| Suggested primer 2: | GACGACAGACAAGTGGCAGA |