| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.025517 |
| Chromosome: | chromosome 3 |
| Location: | 8687455 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g209281 | (1 of 1) IPR000547//IPR001680//IPR011990//IPR015943//IPR017986 - Clathrin, heavy chain/VPS, 7-fold repeat // WD40 repeat // Tetratricopeptide-like helical domain // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACATTTGCCAGATGACATCCCTGTACCCAGGCGCTGTGCTTTCCCACGG |
| Internal bar code: | TAATTGCCCAAATTAAACCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 394 |
| LEAP-Seq percent confirming: | 52.9412 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCATTCCATTCCAGCCACC |
| Suggested primer 2: | ACGTGAGTGTAGGTGTGCAG |