| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.026445 |
| Chromosome: | chromosome 6 |
| Location: | 176766 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g250250 | ATPVC,ATPVC1 | (1 of 1) K02148 - V-type H+-transporting ATPase subunit C (ATPeV1C, ATP6C); Vacuolar ATP synthase subunit C | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGAAACAGCTGGGGGGCTTTCAGCATGGCACGCGACTTCGACTTTCAG |
| Internal bar code: | TAAGGGCCTTGTTGGTAGTGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 446 |
| LEAP-Seq percent confirming: | 30.7692 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTAGACCGGCGTCATACCC |
| Suggested primer 2: | GTAGGGATGGAAGGCGTACG |