Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.027898 |
Chromosome: | chromosome 14 |
Location: | 3779951 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g632050 | POB25,RPG1,RPGRIP1 | Retinitis pigmentosa GTPase regulator-interacting protein 1; (1 of 1) PF11618 - First C2 domain of RPGR-interacting protein 1 (C2-C2_1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAACAAAATGCAAGTCCCTTGCCTAGCCGTTACACGCTCCTGCCCCTCC |
Internal bar code: | GATGAGACCAGTGGTATGCACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2278 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCGATGTTCTTGCCCACT |
Suggested primer 2: | GAGGAGTTCTGGCACAACGA |