| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.028631 |
| Chromosome: | chromosome 13 |
| Location: | 908540 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g567750 | PRP18 | Pre-mRNA splicing factor; (1 of 1) K12817 - pre-mRNA-splicing factor 18 (PRPF18, PRP18) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTCTGGAAAATCCACATTATTGAGGGAGGCGTGTTGATTGGTGCTGAC |
| Internal bar code: | TTTGTAATCTCGGAGGTTTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1288 |
| LEAP-Seq percent confirming: | 57.1429 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCCGCACCTTGTCTTTAT |
| Suggested primer 2: | ACGGCCCCAACATGATTCAT |