Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.028672 |
Chromosome: | chromosome 10 |
Location: | 3126887 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g441650 | (1 of 1) PF06650//PF16908 - SHR-binding domain of vacuolar-sorting associated protein 13 (SHR-BD) // Vacuolar sorting-associated protein 13, N-terminal (VPS13) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACTTGCGGAGGAAGGTGATGCATGGGTCGTGCACGCTGATGACCACGT |
Internal bar code: | CGATCAATAGTGTCTGCAAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4643 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 69 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGCCGCATTCATTCGAGG |
Suggested primer 2: | TGTAAGACACTCACCACGGC |