| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.028784 |
| Chromosome: | chromosome 11 |
| Location: | 1981926 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467772 | CYCD1 | D-type cyclin; (1 of 10) PTHR10177 - CYCLINE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGTCAATACAAGCTGGGTACAGCGGTGCCGAAGAACATTTTGTGAATG |
| Internal bar code: | TGTTATCGGCTGTTTCCTGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2553 |
| LEAP-Seq percent confirming: | 84.7826 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATCGACCATCGCATCTCA |
| Suggested primer 2: | AGCCCAGGAAGCAGTCATTC |