| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.029160 |
| Chromosome: | chromosome 10 |
| Location: | 3539293 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445000 | SLT2 | Sodium/sulfate co-transporter 2; (1 of 2) PF00939//PF02080 - Sodium:sulfate symporter transmembrane region (Na_sulph_symp) // TrkA-C domain (TrkA_C) | 3'UTR |
| Cre10.g445050 | SLT3 | (1 of 1) IPR001898//IPR004680//IPR006037 - Sodium/sulphate symporter // Citrate transporter-like domain // Regulator of K+ conductance, C-terminal; Sodium/sulfate co-transporter 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAGTCCGTGGATAACACTACGGGTATCGATCTTGTCGCTCATGTGCAA |
| Internal bar code: | ATTGTCAAAGTGTGTACCTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5673 |
| LEAP-Seq percent confirming: | 92.0 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTACCTCCGGTCTGCGTA |
| Suggested primer 2: | GGCACGCGCATTTACTACTG |