| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.029633 |
| Chromosome: | chromosome 12 |
| Location: | 2093214 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510200 | BLZ9 | bZIP transcription factor; (1 of 21) IPR004827 - Basic-leucine zipper domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGAGCGGCAAAAGGACCTTATCCACAATTTGAAGGCCAAGGTTGAGGA |
| Internal bar code: | GAGGTGGACTCACATAAGGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2753 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGCTTGCCAGGTCCAAC |
| Suggested primer 2: | CTGGGGACTTGGGAATGGAC |