Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.029633 |
Chromosome: | chromosome 12 |
Location: | 2093214 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g510200 | BLZ9 | bZIP transcription factor; (1 of 21) IPR004827 - Basic-leucine zipper domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGAGCGGCAAAAGGACCTTATCCACAATTTGAAGGCCAAGGTTGAGGA |
Internal bar code: | GAGGTGGACTCACATAAGGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2753 |
LEAP-Seq percent confirming: | 90.9091 |
LEAP-Seq n confirming: | 30 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAAGCTTGCCAGGTCCAAC |
Suggested primer 2: | CTGGGGACTTGGGAATGGAC |