Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.031010 |
Chromosome: | chromosome 4 |
Location: | 1138028 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g215850 | IPA1 | Importin alpha; (1 of 1) PF16186 - Atypical Arm repeat (Arm_3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATATGAAGCGCAGTCAATACTCACCGGGCGCCAGGTTCTGGTCATCGCC |
Internal bar code: | TTTGAAGTACGCTAGGGGGGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4657 |
LEAP-Seq percent confirming: | 94.1176 |
LEAP-Seq n confirming: | 48 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCGTGTCCTTTTTGCTTCG |
Suggested primer 2: | CAAATTGGGTGCAAGGGTCG |