| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.031454 |
| Chromosome: | chromosome 7 |
| Location: | 2116549 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g326450 | VPS5B | (1 of 2) K17917 - sorting nexin-1/2 (SNX1_2); Subunit of Retromer complex | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTCATGCGGTGATGTTGAGGGCCCTCAAGTAGCGCGTGAGAGAATGCA |
| Internal bar code: | ACTTTTAATTACAAATAGATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2145 |
| LEAP-Seq percent confirming: | 97.9167 |
| LEAP-Seq n confirming: | 47 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTGCACCATTATTCGCG |
| Suggested primer 2: | ATGATGTAGCCGCGGTAGTG |