| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.031947 |
| Chromosome: | chromosome 1 |
| Location: | 3863254 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g025400 | HYD3,HYDIN1 | (1 of 1) K17570 - hydrocephalus-inducing protein (HYDIN); Hydrocephalus 3-Like Protein Hydin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAGGACGCGACCGGCTACCTGGAGGGCTCGCACCCGGACAACACGGCC |
| Internal bar code: | TGATACTGGGCTCAAGCACGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4054 |
| LEAP-Seq percent confirming: | 98.7805 |
| LEAP-Seq n confirming: | 81 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAATGACGTCCTCCACCA |
| Suggested primer 2: | CAGCGCTTCAAGGTGTTCAC |