| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.032483 |
| Chromosome: | chromosome 5 |
| Location: | 665360 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g245351 | (1 of 1) PF00059//PF00530//PF00704//PF14295 - Lectin C-type domain (Lectin_C) // Scavenger receptor cysteine-rich domain (SRCR) // Glycosyl hydrolases family 18 (Glyco_hydro_18) // PAN domain (PAN_4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCACGCACGGACCTTCTGGAAATACAAAAGCATAGGCTACCCTCTCCT |
| Internal bar code: | TGCGGCCGCCGCCAAGTAATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1558 |
| LEAP-Seq percent confirming: | 92.1053 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCAGCGTCACAATAGGC |
| Suggested primer 2: | TGTAGTGGCCGAGACGTCTA |