| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.033640 |
| Chromosome: | chromosome 2 |
| Location: | 2553154 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092500 | UPF1 | (1 of 1) PTHR10887//PTHR10887:SF378 - DNA2/NAM7 HELICASE FAMILY // REGULATOR OF NONSENSE TRANSCRIPTS 1 HOMOLOG; UPF1-like RNA helicase, NMD protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGCGCTCATGCGCTCCCACCACGCACTCCCACAGCTGCACACCCGCC |
| Internal bar code: | TATAGTCCGATGTGCAGTTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3160 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTGGTGCTATGGCTGAAC |
| Suggested primer 2: | GACTTCAACAGCCAGGTGGA |