| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.033667 |
| Chromosome: | chromosome 16 |
| Location: | 3057723 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g664301 | POLQ1 | DNA polymerase theta; (1 of 2) K02349 - DNA polymerase theta [EC:2.7.7.7] (POLQ) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGCGGCGAGGCTGCTCGTGCCTGGCCCTGCTGGCCATCACCGTCGGG |
| Internal bar code: | CGAAGATAGAGTGGGCTTTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3490 |
| LEAP-Seq percent confirming: | 96.2963 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCCAAATCCTTCCAGCGT |
| Suggested primer 2: | TAAGAGGCCGTACTCCAGCT |