| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.035094 |
| Chromosome: | chromosome 3 |
| Location: | 4151067 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172900 | (1 of 2) PF11371 - Protein of unknown function (DUF3172) (DUF3172) | 3'UTR | |
| Cre03.g172950 | PUS1,PUS21,CBF5 | TruB family RNA pseudouridine synthase; (1 of 1) K11131 - H/ACA ribonucleoprotein complex subunit 4 (DKC1, NOLA4, CBF5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCGGGGGTGCAACACCTGCTGGTGCACATGGCATATGCCCTCTGGGC |
| Internal bar code: | ACTTTATCATTATATATTACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2370 |
| LEAP-Seq percent confirming: | 95.0 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCGATCCCACTACTGCCA |
| Suggested primer 2: | GTTTGGGACAGCGTGACAAC |