Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.035097 |
Chromosome: | chromosome 13 |
Location: | 1314934 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g571200 | HKR5,HIK5,HIK | (1 of 1) IPR000014//IPR001789//IPR003594//IPR003661//IPR004358//IPR005467//IPR011006 - PAS domain // Signal transduction response regulator, receiver domain // Histidine kinase-like ATPase, C-terminal domain // Signal transduction histidine kinase, dimerisation/phosphoacceptor domain // Signal transduction histidine kinase-related protein, C-terminal // Histidine kinase domain // CheY-like superfamily; Histidine kinase response regulator of two-component system | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCAGCTGTGCGGCGAGCGGGCGCAATGTGTATGTGCGTGTGTGGTGA |
Internal bar code: | TTCTGTATTCAAGTGTGGCATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 976 |
LEAP-Seq percent confirming: | 96.0 |
LEAP-Seq n confirming: | 24 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCATGCTTACACGAATGCA |
Suggested primer 2: | TTCAGCAGTTCCCCACGTAC |