Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.036026 |
Chromosome: | chromosome 16 |
Location: | 7016034 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g673617 | PRF1,PRFA1 | Putative chloroplast peptide chain release factor 1; (1 of 2) PTHR11075:SF9 - PEPTIDE CHAIN RELEASE FACTOR 1, MITOCHONDRIAL-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTCTTTGGGAACCAACTCACACCAAAACTGGAGCCGCAGCAATACCGC |
Internal bar code: | TCGAGAAACCCGCTTTGTCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4258 |
LEAP-Seq percent confirming: | 90.4762 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCTTGTTGCGTTGCTGAA |
Suggested primer 2: | GGCGCGACCATTGTTATGAC |