| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.036182 |
| Chromosome: | chromosome 12 |
| Location: | 5593909 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531150 | XYI1 | (1 of 1) 2.7.1.15//5.3.1.5 - Ribokinase // Xylose isomerase / D-xylose ketoisomerase; ribokinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTACTTCAACTACCCGGAGCACCTGAAGGGCCTCACGCTGCAGCAGGT |
| Internal bar code: | GATAAATTTTACAGACAGTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1767 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTGCGTTCAAAACTGCGA |
| Suggested primer 2: | GTAGCAGCTACGCCAGAGAG |