| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.036356 |
| Chromosome: | chromosome 16 |
| Location: | 2845469 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662902 | (1 of 1) K03754 - translation initiation factor eIF-2B subunit beta (EIF2B2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAGAAGCGGTACAGGATGCACTAAAGACTGCAGACGATGAAGTCGTT |
| Internal bar code: | GTTTAAGAAGTATGCGGCATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 320 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGATGGATGGATTTGCGGC |
| Suggested primer 2: | GGCTAGCAGCACCTAACCAA |