| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.037721 |
| Chromosome: | chromosome 6 |
| Location: | 3103401 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g275350 | ROC40 | (1 of 1) PTHR12802//PTHR12802:SF43 - SWI/SNF COMPLEX-RELATED // PROTEIN CCA1-RELATED; Rhythm Of Chloroplast 40 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAACCCAGTTGAAGATGTGCACTCACCGGGTCTCGGTGTTGGGCGGCT |
| Internal bar code: | GTTGGGAACATAATGACAACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 974 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCACAAGAAGGTAGGCA |
| Suggested primer 2: | CCGTTGTTTCCATTGCCCTG |