| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.037825 |
| Chromosome: | chromosome 7 |
| Location: | 3468956 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g335750 | IFT88 | (1 of 1) K16474 - intraflagellar transport protein 88 (IFT88); Intraflagellar Transport Protein 88 | 3'UTR |
| Cre07.g800815 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAAAGGTGCTGAGCTTTGGCTCGGCTGGGACGTCCAGCGCACTGCCTG |
| Internal bar code: | ACCGCTCGCTGGCGACGGTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4278 |
| LEAP-Seq percent confirming: | 96.7391 |
| LEAP-Seq n confirming: | 89 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 92 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGCCCCATCTGTACTCCT |
| Suggested primer 2: | CACGTGTTTCGATCTCCCCA |