| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.037979 |
| Chromosome: | chromosome 17 |
| Location: | 4180212 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g729250 | UPF2 | (1 of 1) K14327 - regulator of nonsense transcripts 2 (UPF2, RENT2); Putative UPF2 regulator of nonsense transcripts | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCACGTCTGACTGTATGTGTTGTATTGTAAGACATTACGTCAGCTTTC |
| Internal bar code: | TGCGATTGATTGGTGAAGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1030 |
| LEAP-Seq percent confirming: | 76.9231 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAGGTGTGTGTGCCGTAC |
| Suggested primer 2: | AGTACGTGGTCAAGTGCCTG |