| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.038735 |
| Chromosome: | chromosome 7 |
| Location: | 5255698 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g349500 | (1 of 2) PTHR15574:SF40 - WD AND TETRATRICOPEPTIDE REPEATS PROTEIN 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGCCGCGAGGTGGGCGGCGTGGCGGGCGAGGCGCCGGCAGAGGCCTG |
| Internal bar code: | ATATGAGAAGAGTATTTAAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3931 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 77 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 91 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATCGCATCATCACAACC |
| Suggested primer 2: | CGCCTTTACGTCCACCTACA |