Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.039380 |
Chromosome: | chromosome 5 |
Location: | 2350751 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g238332 | PSAD,PSAD1 | Photosystem I reaction center subunit II, 20 kDa; (1 of 1) K02692 - photosystem I subunit II (psaD) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAGCAGCTGGACCGCCTGTACCATGGAGAAGAGCTTTACTTGCCGGG |
Internal bar code: | CTACACGGAGGACTATCTACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 324 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCAGTATGGCATTGGCAGA |
Suggested primer 2: | AGGGGGATCTGGGAATTGGA |