| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.039837 |
| Chromosome: | chromosome 10 |
| Location: | 3534769 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445000 | SLT2 | Sodium/sulfate co-transporter 2; (1 of 2) PF00939//PF02080 - Sodium:sulfate symporter transmembrane region (Na_sulph_symp) // TrkA-C domain (TrkA_C) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGATAGATGCCGCTGACACTGAAACCGGATTGCTGCAGCAGGCCCGAG |
| Internal bar code: | AAAAACGTACTGGTGGAAGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4856 |
| LEAP-Seq percent confirming: | 94.5545 |
| LEAP-Seq n confirming: | 191 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 202 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTGCAGTGGCTGAAAGTG |
| Suggested primer 2: | GCTCCTCATCGTAGAACGGG |