Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.042308 |
Chromosome: | chromosome 13 |
Location: | 3305666 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g586050 | (1 of 1) PTHR13833:SF49 - NHL REPEAT-CONTAINING PROTEIN 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCATGAAGCACGGAGTGATTAATCACAGGTTTGGAGTGCGCCATCAGTA |
Internal bar code: | GTTAATATGAGTGGTTGTATAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 99 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCAGCAACAGCTCCAGCAT |
Suggested primer 2: | ACAAACACAGCAGTCAACGC |