| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.042585 |
| Chromosome: | chromosome 14 |
| Location: | 535419 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611450 | PLP7,PLAP7 | Plastid lipid associated protein 7; (1 of 17) PF04755 - PAP_fibrillin (PAP_fibrillin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGCTCGTCCAGTGCCGGCGGCTCGTCAACGGACGCAAGCACGACGGCG |
| Internal bar code: | AAGATGCGGTTGTAGTATTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4522 |
| LEAP-Seq percent confirming: | 94.2857 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTAAGGCGTCGACTGAGA |
| Suggested primer 2: | CTCCCCTTAGTTCTGGCTGC |