| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.043301 |
| Chromosome: | chromosome 10 |
| Location: | 2971736 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440300 | SMC5A | (1 of 2) PTHR19306//PTHR19306:SF1 - STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 SMC5, SMC6 // STRUCTURAL MAINTENANCE OF CHROMOSOMES PROTEIN 5; Structural Maintenance of Chromosomes protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTAACCAAGGACCTCGGGGAGACTTGCACAGACCGAGATCCCGCAGTG |
| Internal bar code: | TATATGGAAACAACAACTATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 443 |
| LEAP-Seq percent confirming: | 88.4615 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGGATGTGGGTAGGGGAG |
| Suggested primer 2: | GCGCACATACGGATTGACAC |